View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_high_44 (Length: 229)
Name: NF1505_high_44
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_high_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 40180713 - 40180910
Alignment:
| Q |
17 |
gaaggaatagtaacatactgaaaactcatcttggagctcagaacatgaattcccaactggccagagaccagcagaagcagcaaaatgacagcttagttgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40180713 |
gaaggaatagtaacatactgaaaactcatcttggagctcagaacatgaattcccaactggccagagaccagcagaagcagcaaaatgacagcttagttgc |
40180812 |
T |
 |
| Q |
117 |
agcccttggccggcttactgatgctatcacaaaaattgctgacaagatgtagacaaactcaagagaatgaagtattcttcattgcaatcagacatagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40180813 |
agcccttggccggcttactgatgctatcacaaaaattgctgacaagatgtagacaaactcaagagaatgaagtattcttcattgcaatcagacatagt |
40180910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University