View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_high_47 (Length: 224)
Name: NF1505_high_47
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 52601583 - 52601790
Alignment:
| Q |
1 |
aaatcatcagctgcagaaaaaacacagatctcactttaccatcagatatgcagtacctccctgaatatgtaatttctcatcttcatttctaaagtaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52601583 |
aaatcatcagctgcagaaaaaacacagatctcactttaccatcagatatgcagtacctccctgaatatgtaatttctcatcttcatttctaaagtaatct |
52601682 |
T |
 |
| Q |
101 |
tagttattatttgaaccattttttatcttataagaagcttgaaaattaatgtttctatgaatcttaatatttaggcatggaaactttatgagaagtcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52601683 |
tagttattatttgaaccattttttatcttataagaagcttgaaaattaatgtttctatgaatcttaatatttaggcatggaaactttatgagaagtcaat |
52601782 |
T |
 |
| Q |
201 |
ggtaatgg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
52601783 |
ggtaatgg |
52601790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 16909728 - 16909668
Alignment:
| Q |
12 |
tgcagaaaaaacacagatctcactttaccatcagatatgcagtacctccctgaatatgtaa |
72 |
Q |
| |
|
||||| ||||| ||||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
16909728 |
tgcaggaaaaatacagatcatactttaccaccagatatgcaatacctccctgaatatgtaa |
16909668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University