View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_high_50 (Length: 213)
Name: NF1505_high_50
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_high_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 5 - 197
Target Start/End: Original strand, 43918732 - 43918924
Alignment:
| Q |
5 |
tcatttaaactacgcttttatatgaagctctttgcaatatttttgctctcaagtttgccatgttgaataagattatgatatttaaccaatgtcagggtta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43918732 |
tcatttaaactacgcttttatatgaagctctttgcaatatttttgctctcaagtttgccatgttgaataagattatgatatttaaccaatgtcagggtta |
43918831 |
T |
 |
| Q |
105 |
cagatcatgaggcagattgtgacttcatgacaaagaagggataccaaaggaaggatggtaagaaatcttccttgaataaactgataagaaaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43918832 |
cagatcatgaggcagattgtgacttcatgacaaagaagggataccaaaggaaggatggtaagaaatcttccttgaataaactgataagaaaat |
43918924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University