View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_high_51 (Length: 213)
Name: NF1505_high_51
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_high_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 75 - 196
Target Start/End: Complemental strand, 24645306 - 24645185
Alignment:
| Q |
75 |
atctttctcaagcattcctcgcacgtgccgtttacctcaaccctgaaattcgtgcagcttcactctcttccacttcttccctctccttccctgctctcaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24645306 |
atctttctcaagcattcctcgcacgtgccgtttacctcaaccctgaaattcgtgcagcttcactctcttccacttcttccctctccttccctgctctcaa |
24645207 |
T |
|
| Q |
175 |
atcctcctcttcatgcaaacca |
196 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
24645206 |
atcctcctcttcatccaaacca |
24645185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 75 - 196
Target Start/End: Original strand, 52485470 - 52485591
Alignment:
| Q |
75 |
atctttctcaagcattcctcgcacgtgccgtttacctcaaccctgaaattcgtgcagcttcactctcttccacttcttccctctccttccctgctctcaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52485470 |
atctttctcaagcattcctcgcacgtgccgtttacctcaaccctgaaattcgtgcagcttcactctcttccacttcttccctctccttccctgctctcaa |
52485569 |
T |
|
| Q |
175 |
atcctcctcttcatgcaaacca |
196 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
52485570 |
atcctcctcttcatccaaacca |
52485591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University