View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_low_27 (Length: 284)
Name: NF1505_low_27
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 41403294 - 41403535
Alignment:
| Q |
16 |
atgcagttacagatgcagaatccctaaaggtatgtttaaagattcatgattatattttatggtcacaccaacaaataaataaaagaattatttagaatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41403294 |
atgcagttacagatgcagaatccctaaaggtatgtttaaagattcatgattatattttatggtcacaccaacaaataaataaaagaa----------tta |
41403383 |
T |
 |
| Q |
116 |
ttgtattgtatataataattgtggttgaatcaaatataaaatataaatatcaggtaagtcaacatagagaaatatcaaatgctaaaggtcaggctagtag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41403384 |
ttgtattgtatataataattgtggttgaatctaatataaaatataaatatcaggtaagtcaacatagagaaatatcaaatgctaaaggtcaggctagtag |
41403483 |
T |
 |
| Q |
216 |
tgggaatggacttcatcagaagaaagatgtcaagacaacaacggatcaaggt |
267 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
41403484 |
tgggaatgcacttcatcagaagaaagatgtcaatacaacaacagatcaaggt |
41403535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University