View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_low_28 (Length: 283)
Name: NF1505_low_28
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 99 - 240
Target Start/End: Complemental strand, 26713690 - 26713549
Alignment:
| Q |
99 |
taactaccgcaataataagtgtgaaaattttaagaaagagcaatacctataaacccgtgtgggggaaccctcgccgccgctggctgacgttgattccatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26713690 |
taactaccgcaataataagtgtgaaaattttaagacagagcaagacctataaacccgtgtgggggaaccctcgccgccgctggctgacgttgattccatg |
26713591 |
T |
 |
| Q |
199 |
gcaggctgccacgccactccgtcgcttcaatgtaacaatatt |
240 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26713590 |
gcaggctgccactccactccgtcgcttcaatgtaacaatatt |
26713549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 99 - 240
Target Start/End: Complemental strand, 26983429 - 26983288
Alignment:
| Q |
99 |
taactaccgcaataataagtgtgaaaattttaagaaagagcaatacctataaacccgtgtgggggaaccctcgccgccgctggctgacgttgattccatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26983429 |
taactaccgcaataataagtgtgaaaattttaagacagagcaagacctataaacccgtgtgggggaaccctcgccgccgctggctgacgttgattccatg |
26983330 |
T |
 |
| Q |
199 |
gcaggctgccacgccactccgtcgcttcaatgtaacaatatt |
240 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26983329 |
gcaggctgccactccactccgtcgcttcaatgtaacaatatt |
26983288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University