View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_low_32 (Length: 270)
Name: NF1505_low_32
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 139 - 254
Target Start/End: Original strand, 2582276 - 2582391
Alignment:
| Q |
139 |
ttggtttaaaatatatttgtccataaatataagcatctattgcgaatttcattcttattcagaaaaattaatagcagagttaatgtgtctattttatgca |
238 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2582276 |
ttggtttataatatatttgtccataaatataagcatctattctgaatttcattcttattcagaaaaattaatagcagagttaatgtatctattttatgca |
2582375 |
T |
 |
| Q |
239 |
ttaatatacttaaaat |
254 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2582376 |
ttaatatacttaaaat |
2582391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 34 - 98
Target Start/End: Original strand, 2582218 - 2582282
Alignment:
| Q |
34 |
ggtaattggtttcgtaaaaagggaccgattgaaattcactttggctggtttggtggtgttggttt |
98 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2582218 |
ggtaattggtttagtaaaaagggacggattgaaattcactttggctggtttgaaggtgttggttt |
2582282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 105
Target Start/End: Original strand, 35053277 - 35053318
Alignment:
| Q |
63 |
tgaaattcactttggctggtttggtggtgttggtttgagatct |
105 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
35053277 |
tgaaattcacttggg-tggtttggtggtgttggtttgagatct |
35053318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University