View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1505_low_42 (Length: 241)
Name: NF1505_low_42
Description: NF1505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1505_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 44737780 - 44737573
Alignment:
| Q |
18 |
accgggtacaggcagttgtcgtatgggaatgagggctgaaggccgcacagcagcgcaccatgacatgttgtagttgtaaaggtgaggcgcacgccatgcg |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44737780 |
accgggtacaggcagttgtcgtgtgggaatgagggctgaaggccgcacagcagcgcaccatgacatgttgtagttgtaaaggtgagacgcacgccatgcg |
44737681 |
T |
 |
| Q |
118 |
aataagggacggttgaagagaaagaagctcagctccaacacacgtttttgtctgctagataccccacattcacctcgattactcccctcttcatatgcac |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44737680 |
aataagagacggttgaagagaaagaagctcagctccaacacacgtttttgtctgctagataccccacattcacctcgattactcccctcttcatatgcac |
44737581 |
T |
 |
| Q |
218 |
gctttcat |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
44737580 |
gctttcat |
44737573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University