View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15060_high_5 (Length: 338)
Name: NF15060_high_5
Description: NF15060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15060_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 43103125 - 43102805
Alignment:
| Q |
1 |
ttaaaatcatatt-gtcttcttcccctaacaagacaaacataatcatggagcaagtgcatttggtaagtgactacaccaaaccaaatacatgttcctttt |
99 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43103125 |
ttaaaatcatatttgtcttcttcccctaacaagacaaacataatcatggagcaagtgcatttggtaagtgactacaccaaaccaaatacatgttcctttt |
43103026 |
T |
 |
| Q |
100 |
caaccatcatggaagaaatgaaatccctaatgatgcttgcttttccaatagccataacagctcttattttctactctcgttccatggtgtccatgatgtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43103025 |
caaccatcatggaagaaatgaaatccctaatgatgcttgcttttccaatagccataacagctcttattttctattctcgttccatggtgtccatgatgtt |
43102926 |
T |
 |
| Q |
200 |
tttaggctacctaggagaacttgaacttgcagccggttcactcgccatcgccttcgccaacatcaccggctactcagttctctccggtctctctctcgga |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102925 |
tttaggctacctaggagaacttgaacttgcagccggttcactcgccatcgccttcgccaacatcaccggctactcagttctctccggtctctctctcgga |
43102826 |
T |
 |
| Q |
300 |
atggaacctctttgttcacaa |
320 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
43102825 |
atggaacctctctgttcacaa |
43102805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University