View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15061_low_4 (Length: 322)
Name: NF15061_low_4
Description: NF15061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15061_low_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 322
Target Start/End: Complemental strand, 35225890 - 35225586
Alignment:
| Q |
17 |
catcagcttggtaccaactagaggaaacaagttgtgtaactatcaagttaaagaatgagaaaacagttttggatggcctgcagtcacaatcacacacgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35225890 |
catcagcttggtaccaactagaggaaacaagttgtgtaactatcaagttaaagaatgagaaaacggttttagatggcctgcagtcacaatcacacacgtt |
35225791 |
T |
 |
| Q |
117 |
catgtagtcaaaacatgggtgaccgttggatcaagatcggacagtgcagaaagcaaaccgattttaannnnnnnaaaagatctaaaattccgagttaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
35225790 |
catgtagtcaaaacatgggtgaccgttggatcaagatcgga-agtgcagaaagcaaaccgattttaatttttttaaaagatctaaaataccgagttaagg |
35225692 |
T |
 |
| Q |
217 |
acttgcaactggtgtcatctctaacttattagttggagtggctttagtagatacacatcggcactcttatcttgcaatcttgcaattagagcattataca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35225691 |
acttgcaactggtgtcatctctaacttattagttggagtggctttagtagatacacgtcggcagtcttatcttgcaatcttgcaattagagcattataca |
35225592 |
T |
 |
| Q |
317 |
cctttg |
322 |
Q |
| |
|
|||||| |
|
|
| T |
35225591 |
cctttg |
35225586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University