View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15061_low_8 (Length: 244)
Name: NF15061_low_8
Description: NF15061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15061_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 98 - 235
Target Start/End: Complemental strand, 23863676 - 23863539
Alignment:
| Q |
98 |
ctagaacacctttctcttgatgtatctgttcattctcatcaagaatatgttgcacgcaaatagtctcttgaactacaggttcctccaattatgcttcaca |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23863676 |
ctagaacacctttttcttgatgtatctgttcattctcatcaagaatatgttgcacgcaaatagtctcttgaactacaggttcctccaattatgcttcaca |
23863577 |
T |
|
| Q |
198 |
agaaccaggctaatttgcaagaaataccacaggttctg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23863576 |
agaaccaggctaatttgcaagaaataccacaggatctg |
23863539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 23863663 - 23863758
Alignment:
| Q |
8 |
aaaaggtgttctagaaaaggagcttcaaaatgacactacaatagtggatcctgtgtcagacggtgtttgatgctcatgaagcgcatgtgactagaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23863663 |
aaaaggtgttctagaaaaggagcttcaaaatgacactacgatagtggatcctgtgtcagacggtgtttgatgctcatgaagcgcatgtgactagaa |
23863758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University