View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15061_low_9 (Length: 237)
Name: NF15061_low_9
Description: NF15061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15061_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 53 - 223
Target Start/End: Original strand, 46407124 - 46407295
Alignment:
| Q |
53 |
tgattttggggggtgcgagagagaaagagcgttgggaggcagtaaatttcactttcaaacgttactactaactaaggtcagaaggat-----cgtgatat |
147 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46407124 |
tgattttggggggtgcgaga----aagagcgttgggaggcagtaaatttcactttcaaacgttactactaactaaggtcagaaggatgagatcgtgatat |
46407219 |
T |
|
| Q |
148 |
ctgatttcagatatatgaaaaagtaaagcaatcaatcactggcaggtagcagacacgagttgtaggttcaaaattg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46407220 |
ctgatttcagatatatgaaaaagtaaagcaatcaatcactggcaggtagcagacacgagttgtaggtttaaaattg |
46407295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 46407072 - 46407101
Alignment:
| Q |
1 |
acgtccactcctgagtttcagagaggaaat |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46407072 |
acgtccactcctgagtttcagagaggaaat |
46407101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University