View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15062_high_27 (Length: 239)
Name: NF15062_high_27
Description: NF15062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15062_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 23804418 - 23804289
Alignment:
| Q |
1 |
tatcgtattcggtgtctgtgctccgtagtatgtccctatgggtgtcacatcatattca----atctagaagttaatttgggatcatgcttttttcatcgt |
96 |
Q |
| |
|
||||||||| | ||| |||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
23804418 |
tatcgtattggatgtttgtgcttggtagtatgaccctatgggtgtcacatcatattcattcaatctagaagttaatttgggatcatgccttttccatcgt |
23804319 |
T |
|
| Q |
97 |
gcactacacgcccttgatcatgcgtgtgct |
126 |
Q |
| |
|
||||||||||| |||||||||||||||||| |
|
|
| T |
23804318 |
gcactacacgcacttgatcatgcgtgtgct |
23804289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 228
Target Start/End: Complemental strand, 23804215 - 23804187
Alignment:
| Q |
200 |
agactatgttcctttgaagtgtgttctgt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23804215 |
agactatgttcctttgaagtgtgttctgt |
23804187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University