View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15062_high_31 (Length: 229)

Name: NF15062_high_31
Description: NF15062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15062_high_31
NF15062_high_31
[»] chr2 (1 HSPs)
chr2 (3-222)||(26169565-26169777)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 26169777 - 26169565
Alignment:
3 aagctaccataccaaccttgtaaatctctcggagactataaacacaatcaaccatatctatgtaatcaaaatcttattgaaaaataatggcaccatattc 102  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
26169777 aagctaccataccaaccttgtaaatctc--ggagactataaacacaatcaaccatatctatgtaatcaaaatcttattgaaaaataatggcaccataatc 26169680  T
103 tggtgtttgtacatatagcttggaaactgatattgagtttttcaattattaaagaaaaatggcattgactttttctgataactatatacataaattaaat 202  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||    
26169679 tggtgtttgtacatatagcttggaaactgatattgag-ttttcaattattaaagaaaaatggcattgactttttctgataac----tacataaattaaat 26169585  T
203 agaattctcccatgaagaat 222  Q
    ||||||||||||||||||||    
26169584 agaattctcccatgaagaat 26169565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University