View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15062_low_10 (Length: 412)
Name: NF15062_low_10
Description: NF15062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15062_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 385
Target Start/End: Complemental strand, 5469604 - 5469529
Alignment:
| Q |
310 |
gaatttcagtgtgaaattcaattagctagattaatgattatggatggtttaatttattcacttgaaagaattatta |
385 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
5469604 |
gaatttcggtgtgaaattcaattagctagattaatgattatggatgctttaatttattcacttgaaagaataatta |
5469529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 5469995 - 5469943
Alignment:
| Q |
48 |
tctcttctcacttgcatttatttatcaag--tatgtaatttgtatttagaaag |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
5469995 |
tctcttctcacttgcatttatttatcaagtatatgtaatttgtatctagaaag |
5469943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University