View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15062_low_22 (Length: 287)
Name: NF15062_low_22
Description: NF15062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15062_low_22 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 2561810 - 2561524
Alignment:
| Q |
1 |
aagtctctcctccaccgctctatttgtacccaaactcttgaaccaagtgtaaggattcccatcaaggttaatatcaatcaaacctgcattatgaatagct |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2561810 |
aagtctctcctccaccgctctatctgtacccaaactcttgaaccaagtgtaaggatacccatcaaggttaatatcaatcaaacctgcatcatgaatagct |
2561711 |
T |
 |
| Q |
101 |
catctttagccatttatcaaccagaatggacggactgttctccccttcttttcatgtgcatgaaggatatcgttaaaatctccaaaaatgcaccatggga |
200 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2561710 |
cttctttagccatttatcaaccaggatggacggactgttctccccttcttttcatgtgcatgaaggatatcgttaaaatctccaaaaatgcaccatggca |
2561611 |
T |
 |
| Q |
201 |
gagaagtactatttgctaattgataaatgaaatttcaagaatctcttctcctcctcccatcggggaagccataataacccgttaact |
287 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2561610 |
gagaagtactatttgctaattgacgaatgaaattccaagaatctcttctcctcctcccatcggggaagccataataacccgttaact |
2561524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University