View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15062_low_29 (Length: 241)
Name: NF15062_low_29
Description: NF15062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15062_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 25 - 222
Target Start/End: Original strand, 1537937 - 1538134
Alignment:
| Q |
25 |
atatggtggtgttacctaaatatttgtaagcaacttagttaggttaaaagagtttctggcttttgaaattggtttggaatgaactgatgcatctcctgcc |
124 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1537937 |
atatggtggtgttacctaaatatttctaagcaacttagttaggttaaaagagtttctggcttttgaaattggtttggaatgtactgatgcatctcctgcc |
1538036 |
T |
 |
| Q |
125 |
agatgactagacatacccacacaattcattaaattcagctcttgtgaagaataggtagatgtcatacaataaagtatgagcaacaaggatgtttataa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1538037 |
agatgactagacatacccacacaattcattaaattcagctcttgtgaagaataggtagatgtcatacaataaagtatgagcaacaagtatgtttataa |
1538134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University