View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15063_high_5 (Length: 242)
Name: NF15063_high_5
Description: NF15063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15063_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 17 - 127
Target Start/End: Complemental strand, 3253461 - 3253351
Alignment:
| Q |
17 |
ataaactttcatggaaggagccaagtgctacatgtgtgtatgtggctatatgcctattttaggattgtttactttggaattgtgattacaaagatgaatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3253461 |
ataaactttcatggaaggagccaagtgctacatgtgtgtatgtggctatatgcctatgttaggattgtttactttggaattgtgattacaaagatgaatc |
3253362 |
T |
 |
| Q |
117 |
atggaatggaa |
127 |
Q |
| |
|
||||||||||| |
|
|
| T |
3253361 |
atggaatggaa |
3253351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 203 - 232
Target Start/End: Complemental strand, 3253275 - 3253246
Alignment:
| Q |
203 |
gtatatgggctatgtatgtggattattcat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3253275 |
gtatatgggctatgtatgtggattattcat |
3253246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University