View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15064_low_1 (Length: 238)
Name: NF15064_low_1
Description: NF15064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15064_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 23230974 - 23230752
Alignment:
| Q |
1 |
ttgaaatttctatctttcttggacgtatattctggctataactagatacacatggattcacatgatcaagacaagacaaccttcacgaccgatttaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23230974 |
ttgaaatttctatctttcttggacgtatagtctggctataactagatacacatggattcacatgatcaagacaacacaaccttcttgaccgatttaagaa |
23230875 |
T |
|
| Q |
101 |
acttcttctacaaggtactgcccttcggtataacaaacacatggacaacatgccaaaggatgaactaaatgtttaaataccacataaggaacatgttgta |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
23230874 |
acttattctacaaggtactgcccttcggtataacaaacacatggacaacatgccaaaggatgaactaaaagtttaaataccatataaggaacatgttgta |
23230775 |
T |
|
| Q |
201 |
ggtttacatggacggcatgattg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
23230774 |
ggtttacatggacggcatgattg |
23230752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University