View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15066_low_4 (Length: 214)
Name: NF15066_low_4
Description: NF15066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15066_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 5 - 197
Target Start/End: Original strand, 5369469 - 5369661
Alignment:
| Q |
5 |
aaagaccggtgattcagaaaatacatatatgagcagtcctctctccattcgtatcactgccacaataaaaaatgttattaataatcgagaccatgttgtc |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5369469 |
aaagatcggtgattcagagaatacatatatgagcagccctctctccattcgtatcactgccacaataaaaaatgttattaataattgagaccatgttgtc |
5369568 |
T |
|
| Q |
105 |
tcttttgtttatatttgtttgtgaggatcatggatgagagaaatataccttctctcactgcacaattaaaatattttctacaaacattgcatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5369569 |
tcttttgtttatatttgtttgtgaggatcatggatgagagaaatataccttctctcactgcacaattaaaatattttctacaaacattgcatt |
5369661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University