View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15066_low_5 (Length: 208)
Name: NF15066_low_5
Description: NF15066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15066_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 188
Target Start/End: Complemental strand, 33453767 - 33453599
Alignment:
| Q |
20 |
attacgaattgggtctaccagtaattaaaaaagctggtgttgatcacaaaattgatttcagagaaggtccagctcttccagttcttgatgagatgatcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33453767 |
attacgaattgggtctaccagtaattaaaaaagctggtgttgatcacaaaattgatttcagagaaggtccagctcttccagttcttgatgagatgatcaa |
33453668 |
T |
|
| Q |
120 |
agacgtaagctttaccatctttttctatgatgtcccacttgaagagaaaaagatacatttatgagaata |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33453667 |
agacgtaagctttaccatctttttctatgatgtcccacttgaagagaaaaagatacatttatgagaata |
33453599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University