View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15067_high_5 (Length: 304)

Name: NF15067_high_5
Description: NF15067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15067_high_5
NF15067_high_5
[»] chr5 (2 HSPs)
chr5 (43-290)||(2339846-2340093)
chr5 (190-243)||(12576969-12577021)
[»] chr8 (5 HSPs)
chr8 (123-290)||(7749887-7750057)
chr8 (190-248)||(4011199-4011256)
chr8 (43-76)||(7750098-7750131)
chr8 (212-248)||(38178390-38178426)
chr8 (212-248)||(45512625-45512661)
[»] chr7 (1 HSPs)
chr7 (215-244)||(29229614-29229643)
[»] chr4 (4 HSPs)
chr4 (190-243)||(47147494-47147546)
chr4 (212-248)||(31339651-31339687)
chr4 (191-243)||(49987529-49987580)
chr4 (191-243)||(53540411-53540462)
[»] chr3 (1 HSPs)
chr3 (212-248)||(31261072-31261108)
[»] chr1 (1 HSPs)
chr1 (212-248)||(6025721-6025757)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 43 - 290
Target Start/End: Complemental strand, 2340093 - 2339846
Alignment:
43 tcatgaaatttgaaaacataagaacccaacacttttgaatcaatagtggaagcaaaggctnnnnnnnnnnnnnnnnncacgcattatcccattaggtgag 142  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                 |||||| ||||||||||||||||    
2340093 tcatgaaatttgaaaacataagaacccaacacttttgaatcaatagtggaagcaaaggctacaacaacaacaacaaccacgcagtatcccattaggtgag 2339994  T
143 tggctagatggatcaatcacgtcaataactaaaccatcgaaatataaatctttcttaatagttttagcctatagtttttcttggtcttcctctgcctcta 242  Q
    |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2339993 tggctagatggatcgatcacgtcaataactaaaccattgaaatataaatctttcttaatagttttagcctatagtttttcttggtcttcctctgcctcta 2339894  T
243 gcgattaggctgcacttcataatcaattctcctactatacaacctatg 290  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||    
2339893 gcgattaggctgcactccataatcaattctcctactatacaacctatg 2339846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 243
Target Start/End: Original strand, 12576969 - 12577021
Alignment:
190 atctttcttaatagttttagcctatagtttttcttggtcttcctctgcctctag 243  Q
    ||||||||||||||||| | | | |||||||||| |||||||||||||||||||    
12576969 atctttcttaatagttt-atcttgtagtttttctaggtcttcctctgcctctag 12577021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 123 - 290
Target Start/End: Complemental strand, 7750057 - 7749887
Alignment:
123 gcattatcccattaggtgagtg-gctagatggatcaatcacgtcaataactaaaccatcgaaatataaatctttcttaatagttttagcctatagttttt 221  Q
    ||||||||  |||||||||||  |||| ||||||||||||  || ||| ||||||||  || || ||||||||||||||||||||| ||||||||||||     
7750057 gcattatcttattaggtgagtcagctatatggatcaatcatatctatagctaaaccactgacatctaaatctttcttaatagtttttgcctatagttttg 7749958  T
222 cttggtcttcctctgcctctagcgattaggctgcacttca--taatcaattctcctactatacaacctatg 290  Q
    |||||| ||||||||||||| ||||||||| ||| |  ||  ||||||| |||||||||| | ||||||||    
7749957 cttggtattcctctgcctctggcgattaggttgcccaccatctaatcaactctcctactacagaacctatg 7749887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 4011256 - 4011199
Alignment:
190 atctttcttaatagttttagcctatagtttttcttggtcttcctctgcctctagcgatt 248  Q
    |||||||||||||||||   | |||||||||||| |||||||||||| |||||||||||    
4011256 atctttcttaatagtttct-cttatagtttttctaggtcttcctctgtctctagcgatt 4011199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 76
Target Start/End: Complemental strand, 7750131 - 7750098
Alignment:
43 tcatgaaatttgaaaacataagaacccaacactt 76  Q
    ||||||||||||||||||||||| ||||||||||    
7750131 tcatgaaatttgaaaacataagagcccaacactt 7750098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 248
Target Start/End: Original strand, 38178390 - 38178426
Alignment:
212 tatagtttttcttggtcttcctctgcctctagcgatt 248  Q
    |||||||||||| ||||||||||| ||||||||||||    
38178390 tatagtttttctaggtcttcctctacctctagcgatt 38178426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 248
Target Start/End: Original strand, 45512625 - 45512661
Alignment:
212 tatagtttttcttggtcttcctctgcctctagcgatt 248  Q
    |||||||||||| ||||||||||||||||||| ||||    
45512625 tatagtttttctaggtcttcctctgcctctagtgatt 45512661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 215 - 244
Target Start/End: Original strand, 29229614 - 29229643
Alignment:
215 agtttttcttggtcttcctctgcctctagc 244  Q
    ||||||||||||||||||||||||||||||    
29229614 agtttttcttggtcttcctctgcctctagc 29229643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 243
Target Start/End: Complemental strand, 47147546 - 47147494
Alignment:
190 atctttcttaatagttttagcctatagtttttcttggtcttcctctgcctctag 243  Q
    |||||||||||||||||   | |||||||||||| |||||||||||||||||||    
47147546 atctttcttaatagtttcttc-tatagtttttctaggtcttcctctgcctctag 47147494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 248
Target Start/End: Complemental strand, 31339687 - 31339651
Alignment:
212 tatagtttttcttggtcttcctctgcctctagcgatt 248  Q
    |||||||||||| ||||||||||||||||||| ||||    
31339687 tatagtttttctaggtcttcctctgcctctagtgatt 31339651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 49987580 - 49987529
Alignment:
191 tctttcttaatagttttagcctatagtttttcttggtcttcctctgcctctag 243  Q
    ||||||||||||||||   | |||||||||||| |||||||||||||||||||    
49987580 tctttcttaatagtttct-cttatagtttttctaggtcttcctctgcctctag 49987529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 53540462 - 53540411
Alignment:
191 tctttcttaatagttttagcctatagtttttcttggtcttcctctgcctctag 243  Q
    |||||| ||||||||| | | |||||||||||| |||||||||||||||||||    
53540462 tctttcctaatagttt-atcttatagtttttctaggtcttcctctgcctctag 53540411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 248
Target Start/End: Original strand, 31261072 - 31261108
Alignment:
212 tatagtttttcttggtcttcctctgcctctagcgatt 248  Q
    |||||||||||| ||||||||||||||||||| ||||    
31261072 tatagtttttctaggtcttcctctgcctctagtgatt 31261108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 248
Target Start/End: Complemental strand, 6025757 - 6025721
Alignment:
212 tatagtttttcttggtcttcctctgcctctagcgatt 248  Q
    |||||||||||| ||||||||||||||||||| ||||    
6025757 tatagtttttctaggtcttcctctgcctctagtgatt 6025721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University