View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1506_low_16 (Length: 298)
Name: NF1506_low_16
Description: NF1506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1506_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 37035851 - 37036113
Alignment:
| Q |
1 |
cgcatgaggcaagcaaggcctgaaagagtgaatcgtcgaacagaaggaaggacttcgtactagggctggaatcaaagttgaaatttgtttctctttcaaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||| | ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
37035851 |
cgcacgaggcaagcaaggcctgaaagagtgaatcgtcgaacaggaggaatgacttcgtaccaaggctggaatcaaagtggaaattcgtttctctttcaaa |
37035950 |
T |
 |
| Q |
101 |
gctagaagcacagttctggaagcaaagccaagttttatctctggttcacaagcttgacgttctcaaggcgcggaacgctttggttcgtaagttaggttat |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
37035951 |
gctagaagcacacttctggaagcaaagccaagttctatctctggttcacaagcctgacgttctcaaggcgtggaaggctttggttcgtaagtcaggttat |
37036050 |
T |
 |
| Q |
201 |
ctttctcttgacgctttcatgctttcaccttcggaaacttttatatattttaatgaaattcta |
263 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37036051 |
ctttctcctgacgctttcatgctttcaccttcggaaacttttatatattttaatgaaattcta |
37036113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University