View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1506_low_27 (Length: 235)
Name: NF1506_low_27
Description: NF1506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1506_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 10365858 - 10365666
Alignment:
| Q |
1 |
ctttcttttagtccatgacaaaaatattgaaatttaatttagctcatcgtagtaaaaatgtaatttttagttctcacaaaactaaatcgaaacactttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| ||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
10365858 |
ctttcttttagtccatgacaaaaatattgaaacttaatttgactcatcatagtaaaaatgtaacttttagtcctcacaaaaataaatcgaaacactttag |
10365759 |
T |
 |
| Q |
101 |
tccttaattgaacctttatcgagaaatttgannnnnnnngtcgatatgcgatactttcgtccaatgtgaaagtttactttatcatgatatttg |
193 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||| |||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
10365758 |
tccttaattgaacctctatcgagaaatttgattttttttgtcaatatgtgatacttttgtccaatgtgaaagtttactttgtcatgatatttg |
10365666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University