View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1506_low_6 (Length: 489)
Name: NF1506_low_6
Description: NF1506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1506_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 445; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 16 - 480
Target Start/End: Original strand, 3050150 - 3050614
Alignment:
| Q |
16 |
catgggagattggcctcttcgtcaaagggttttgatatctactaggccacggttcaggttgcgtttaactgtgattctctacgatatgaagaactaagac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3050150 |
catgggagattggcctcttcgtcaaagggttttgatatctactaggccgcggttcaggttgcgtttaactgtgattctctacaatatgaagaactaagac |
3050249 |
T |
|
| Q |
116 |
atgaccacaaccctgctcataactattacttttggcgcttttgcttttgggtggatggggtaaacaaattaggatctaagggggcaggcgtagtttaact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3050250 |
atgaccacaaccctgctcataactattacttttggtgctttttcttttgggtggatggggtaaacaaattaggatctaagggggcaggcgtagtttaact |
3050349 |
T |
|
| Q |
216 |
gaatgctgaaaatggggtcattatctcctttggcttccaaagatgttatggaacaatggtcacagttattcagtacacttgatctaggtctcatgtagtc |
315 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3050350 |
gaatgctgaaaatgggttcattatctcctttggcttccaaagatgttatggaacaatggtcacagttattcagtacacttgatctaggtctcatgtagtc |
3050449 |
T |
|
| Q |
316 |
aaatgtagcttcaattgtggtcacattgcaatcattgagacatctacaaccttgatgtcccagcctagatcacaaggatagaaggaacacagtctctagg |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3050450 |
aaatgtagcttcaattgtggtcacattgcaatcattgagacatctacaaccttgatgtcccagcctagatcacaaggatagaaggaacacagtctctagg |
3050549 |
T |
|
| Q |
416 |
aagatgaaattttacttttgtttttatgcaatgtgtattaagcatcagtgaagttagattttctt |
480 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3050550 |
aagatgaaattttacttttgtttttatgcaatgtgtattaagcatcagtgaagttagattttctt |
3050614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University