View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507-Insertion-22 (Length: 98)
Name: NF1507-Insertion-22
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507-Insertion-22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 4e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 10824346 - 10824262
Alignment:
| Q |
8 |
acgtgtcttcttgattttgtatagcagattgtatatgatctttgatctgcttgtttccatagcttcaatctacatcacatgagac |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10824346 |
acgtgtcttcttgattttgtatagcagattgtatatgatctttgatctgcttgtttccatagcttcaatctacatcacatgagac |
10824262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 10824404 - 10824368
Alignment:
| Q |
8 |
acgtgtcttcttgattttgtatagcagattgtatatg |
44 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
10824404 |
acgtgtcttcttgatcttgtatagaagattgtatatg |
10824368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University