View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507-Insertion-24 (Length: 100)
Name: NF1507-Insertion-24
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507-Insertion-24 |
 | |
|
| [»] chr3 (6 HSPs) |
| |
|
| [»] scaffold0201 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 1e-26; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 36 - 100
Target Start/End: Complemental strand, 23406171 - 23406107
Alignment:
| Q |
36 |
agaattttctttaggatttcacttcctagaaaaaatagactttaattgcattgtgtgtttggtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23406171 |
agaattttctttaggatttcacttcctagaaaaaatagactttaattgcactgtgtgtttggtat |
23406107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 23464831 - 23464739
Alignment:
| Q |
8 |
tcgagtatcataaaacttttcnnnnnnnagaattttctttaggatttcacttcctagaaaaaatagactttaattgcattgtgtgtttggtat |
100 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23464831 |
tcgagtatcataaaacttttatttttttataattttctttaggatttcacttcctagaaaaaatagactttaattgcactgtgtgtttggtat |
23464739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 37 - 87
Target Start/End: Complemental strand, 23480111 - 23480061
Alignment:
| Q |
37 |
gaattttctttaggatttcacttcctagaaaaaatagactttaattgcatt |
87 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
23480111 |
gaattttcattaggatttcacttcctagaaaatttagacattaattacatt |
23480061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 82
Target Start/End: Complemental strand, 23448783 - 23448738
Alignment:
| Q |
37 |
gaattttctttaggatttcacttcctagaaaaaatagactttaatt |
82 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
23448783 |
gaattttctttaggatttcacttcctaaaaaaataagacattaatt |
23448738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 74
Target Start/End: Complemental strand, 23455501 - 23455468
Alignment:
| Q |
41 |
tttctttaggatttcacttcctagaaaaaataga |
74 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
23455501 |
tttctttaggatttcacttcgtagaaaaaataga |
23455468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 82
Target Start/End: Complemental strand, 23500546 - 23500502
Alignment:
| Q |
38 |
aattttctttaggatttcacttcctagaaaaaatagactttaatt |
82 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
23500546 |
aattttctttaggatttcacttcctaaaaaaataagacattaatt |
23500502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0201 (Bit Score: 31; Significance: 0.000000008; HSPs: 1)
Name: scaffold0201
Description:
Target: scaffold0201; HSP #1
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 37 - 87
Target Start/End: Complemental strand, 12929 - 12879
Alignment:
| Q |
37 |
gaattttctttaggatttcacttcctagaaaaaatagactttaattgcatt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |||||| |||| |
|
|
| T |
12929 |
gaattttctttaggatttcatttcctagaaaatttagacattaattacatt |
12879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University