View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507-Insertion-36 (Length: 334)
Name: NF1507-Insertion-36
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507-Insertion-36 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 8 - 334
Target Start/End: Original strand, 45589431 - 45589755
Alignment:
| Q |
8 |
caattttcatcatcatcttcatcaaatttgacagtacctaattcatctggtaattcacagttactttt-tgtccttctgttatgccattgccatcacttt |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45589431 |
caattttcatcatcatcttca---aatttgacagtacctaattcatctggtaattcacagttacttttttgtccttctgttatgccattgccatcacttt |
45589527 |
T |
|
| Q |
107 |
ttactagtactctgaatgctccatcaatggaaagtagtgatattcaaagaaaatccaaccatgttcagatcttgaactcctcaagtaatggttctttcat |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45589528 |
ttactagtactcttaatgctccatcaatggaaagtagtgatattcaaagacaatccaaccatgttcagatcttgaactcctcaagtaatggttctttcat |
45589627 |
T |
|
| Q |
207 |
tccaactattcatcttccaataaattcgccttttagacgccatccaacactgtttagttccaagcttcttgattcagatcataatatataacgccagaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45589628 |
tccaactattcatcttccaataaattcgccttttagacgccatccaacactgtttagttccaagcttcttgattcagatcataatatataacaccagaaa |
45589727 |
T |
|
| Q |
307 |
tgggtagttatggtagtacttttgttgt |
334 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45589728 |
tgggtagttatggtagtacttttgttgt |
45589755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University