View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507-Insertion-40 (Length: 307)
Name: NF1507-Insertion-40
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507-Insertion-40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 304
Target Start/End: Complemental strand, 3521194 - 3520897
Alignment:
| Q |
8 |
ttcaccactcaccgtttttgtaaccggagcttctgggttcatcgg-atggctgtctcgctcgctcttaagcaaggtggggatggggttttagggattgat |
106 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||| ||| |||| ||| |||||||||||||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
3521194 |
ttcaccactcaccgttcttgtcaccggcgcttctggtttcgtcggtatgcatgtctcgctcgctcttaagcgacgtggcgatggggttttagggattgat |
3521095 |
T |
|
| Q |
107 |
aatttcaatcggtactatgatattaacctcaaacgcactcgtgcgaaggttctttcacgcactggtgtttttgtcgttgaaggtgatatcaatgatgttc |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521094 |
aatttcaatcggtattatgatattaacctcaaacgcactcgtgccaaggttctttcacgcgctggtgtttttgtcgttgaaggtgatatcaatgatgttc |
3520995 |
T |
|
| Q |
207 |
atcttcttcgtaaactgtttgatgttgttgcttttactcatgttatgcatcttgctgctaaagctggggttcgatatgcgatgcgaaatcctaattcg |
304 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
3520994 |
atcttctccgtaaactgtttgatgttgttgcttttacgcatgttatgcatcttgctgctcaagctggggttcgttatgctatgcgaaaccctaattcg |
3520897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 140
Target Start/End: Complemental strand, 42373672 - 42373630
Alignment:
| Q |
98 |
gggattgataatttcaatcggtactatgatattaacctcaaac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
42373672 |
gggattgataatttcaatcggtactatgatgttaacctaaaac |
42373630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University