View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507-Insertion-42 (Length: 61)
Name: NF1507-Insertion-42
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507-Insertion-42 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 6 - 61
Target Start/End: Complemental strand, 24362163 - 24362108
Alignment:
| Q |
6 |
cattcttgccaagtatgtgtacaaggaacttagaagttccttcttcatatttaaac |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24362163 |
cattcttgccaagtatgtgtacaaggaacttagaagttccttcttcataattaaac |
24362108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University