View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507-Insertion-44 (Length: 63)
Name: NF1507-Insertion-44
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507-Insertion-44 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 3e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 7 - 63
Target Start/End: Original strand, 30099910 - 30099966
Alignment:
| Q |
7 |
agagttcttgcagcttatattcctaacaagccaacagctagaattggcacaaatgtg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30099910 |
agagttcttgcagcttatattcctaacaaaccaacagctagaattggcacaaatgtg |
30099966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University