View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507-Insertion-46 (Length: 260)
Name: NF1507-Insertion-46
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507-Insertion-46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 8 - 233
Target Start/End: Complemental strand, 47477724 - 47477495
Alignment:
| Q |
8 |
tatggactcgatggtgggaatgaaattttggttggaaaggtatatacatattaataataactacaagaattggtactttgccaagaggtcctgggtttaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47477724 |
tatggactcgatggtgggaatgaaattttggttggaaaggtatatacatattaataataactacaagaattggtactttgccaagaggtcctgggtttaa |
47477625 |
T |
|
| Q |
108 |
atccggacagacgagtaaatagtaatctcacaactaactaattagtaacatttatcattnnnnnnnntgccaagaatttcttttatgttctaaatttaat |
207 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47477624 |
atctggacagacgagtaaatagtaatctcacaactaactaactagtaacatttatcattaaaaaaaatgccaagaatttcttttatgttctaaatttaat |
47477525 |
T |
|
| Q |
208 |
accgcaattg----ttatgccaatttgagc |
233 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
47477524 |
accgcaattgaaacttatgccaatttgagc |
47477495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 47486898 - 47486857
Alignment:
| Q |
8 |
tatggactcgatggtgggaatgaaattttggttggaaaggta |
49 |
Q |
| |
|
|||||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
47486898 |
tatggagtcgatggtggtaatgaaatattggttggaaaggta |
47486857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 148
Target Start/End: Original strand, 2097125 - 2097181
Alignment:
| Q |
92 |
gaggtcctgggtttaaatccggacagacgagtaaatagtaatctcacaactaactaa |
148 |
Q |
| |
|
||||||||||||| ||| ||||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
2097125 |
gaggtcctgggttcaaacccggacaagggagtaaatattaatctaacaactaactaa |
2097181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University