View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1507-Insertion-47 (Length: 244)
Name: NF1507-Insertion-47
Description: NF1507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1507-Insertion-47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 39 - 219
Target Start/End: Original strand, 29977997 - 29978190
Alignment:
| Q |
39 |
gcttttgatcactgaaattctgttttgttaggttatttgtttctaccatgaggtcattcat-----------acgacacatcatgtcatcatatgatatc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29977997 |
gcttttgatcactgaaattctgttttgttaggttatttgtttctaccatgaggccattcattggatgaagacacgacacatcatgtcatcatatgatatc |
29978096 |
T |
|
| Q |
128 |
atctaaattatttagatatacttcatatgaattcacattttataaacttta--atatatatcaattatatcttagcattcaaacgaacattttc |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29978097 |
atctaaattatttagatatacctcatatgaattcacattttataaactctaatatatatatcaattatatcttagcattcaaacgaacactttc |
29978190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University