View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15070_low_4 (Length: 239)
Name: NF15070_low_4
Description: NF15070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15070_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 4 - 121
Target Start/End: Original strand, 42656696 - 42656813
Alignment:
| Q |
4 |
gaccgactttgtttttgattaatatctgtcgaggatctaactgaccatttttagtaaggtctcaatctacaaagcttaaacacaagaccttatctaaaaa |
103 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42656696 |
gaccgactttattgttgattaatatctgtcgaggatctaactgaccacttttagtaaggtctcaatctacaaagcttaaacacaagaccttatctaaaaa |
42656795 |
T |
 |
| Q |
104 |
tctgagttagtttcactc |
121 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42656796 |
tctgagttagtttcactc |
42656813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University