View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15072_high_2 (Length: 401)
Name: NF15072_high_2
Description: NF15072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15072_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 18 - 377
Target Start/End: Complemental strand, 5160025 - 5159666
Alignment:
| Q |
18 |
tcttgtatccataccaatgagtcagtgtgctcgagtgcaacgcgtattttctccgggtcgcgccgcggaaaccctactgctacgaatattttgttaagtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5160025 |
tcttgtatccataccaatgagtcagtgtgctcgagtgcaacgcgtattttctccgggtcgcgccgcggaaaccctactgctacaaatattttgttaagtg |
5159926 |
T |
 |
| Q |
118 |
cttctaggtttaacccctctgcggttcggcggagaatgaaacctcgcttttctagggtttcgtcggatattgagagtgggtagtctaggcttgcttgaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5159925 |
cttctaggtttaacccctctgcggttcggcggagaatgaaacctcgcttttctagggtttcgtcggatattgagagtgggtagtctaggcttgcttgaca |
5159826 |
T |
 |
| Q |
218 |
agaaatggtgaggtttcgtgggtgagtttgtgatttgaagttaagtcgtagggaggatggaacaggagcatagatgttgccacgtaagagcatattatct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5159825 |
agaaatggtgaggtttcgtgggtgagtttgtgatttgaagttaagtcgtagggaggatggaacaggagcatagatgttgccacgtaagagcatattatct |
5159726 |
T |
 |
| Q |
318 |
tatcacaagaacaagatacctcgtcttttttatgctctctctattcttcagaatttgtag |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5159725 |
tatcacaagaacaagatacctcgtcttttttatgctctctctattcttcagaatttgtag |
5159666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University