View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15072_low_3 (Length: 238)
Name: NF15072_low_3
Description: NF15072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15072_low_3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 5159643 - 5159405
Alignment:
| Q |
1 |
cctttgtgtagtctgagaatgagtgatgttttttctggtttggtttgtggttgtgaaagagctgttgaggataatgtgattagtttggttggtaggtatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5159643 |
cctttgtgtagtctgagaatgagtgatgttttttctggtttggtttgtggttgtgaaagagctgttgaggataatgtgattagtttggttggtagttatt |
5159544 |
T |
|
| Q |
101 |
ggctatgtgctttcttcttgttgggtccacaaatagccatgctttgcaa-ataaagtttagataagggaaaacattccatggagaattatcagttaaatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5159543 |
ggctatgtgctttcttcttgttgggtccacaaatagccatgctttgcaagataaagtttagataagggaaaacataccatggagaattatcagttaaatt |
5159444 |
T |
|
| Q |
200 |
tgacagattaaacacaggagtacttcttatgtgtctctg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5159443 |
tgacagattaaacacaggagtacttcttatgtgtctctg |
5159405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University