View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15073_high_4 (Length: 412)
Name: NF15073_high_4
Description: NF15073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15073_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 9 - 396
Target Start/End: Complemental strand, 32528349 - 32527963
Alignment:
| Q |
9 |
agatgaatgtttgtccattgttatttcagaactctggcggttacgtcagtggttttggnnnnnnnnnccccatctaggtaggttcagtttgaaatcttta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32528349 |
agatgaatgtttgtccattgttatttcagaactctggcggttacgtcagtggttttggaagaaaaa-ccccatctaggtaggttcagtttgaaatcttta |
32528251 |
T |
|
| Q |
109 |
gtttgtggttgtatttcttgcctctgatttctggttctttccaaatctacaactttcaaggcgtttggtttattgccaaccacaatggtggttttgtgtc |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528250 |
gtttgtggctgtatttcttgcctctgatttctggttctttccagatctacaactttcaaggcgtttggtttattgccaaccacaatggtggttttgtgtc |
32528151 |
T |
|
| Q |
209 |
tgttaatatttgatggtgttctttcatgtgttgtcgttttactatttatggtgctcagatttgtcgatccctcattttggatatgcgattggttatcggt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32528150 |
tgttaatatttgatggtgttctttcatgtgtcgtcgttttactatttatggtgctcagatttgtcgatccctcattttggatatgtgattggttatcggt |
32528051 |
T |
|
| Q |
309 |
cattttatgtatcaagaccttttcacttccgtgattcttagttatggttttgtttggctcgaaagcgcctatgtttgattcacacaac |
396 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528050 |
cattttatgtatcaagaccttttcgcttccgtgattcttagttatggttttgtttggctcgaaagcgcctatgtttgattcacacaac |
32527963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University