View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15073_low_13 (Length: 250)
Name: NF15073_low_13
Description: NF15073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15073_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 13 - 159
Target Start/End: Complemental strand, 46748832 - 46748686
Alignment:
| Q |
13 |
ggagcagagacggcggagggcggtgagtttggggtcggagtcggaatttgaggaacgatttttacggagttgggaagatggtttcgctgagatggaattg |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748832 |
ggagaagagacggcggagggcggtgagtttggggtcggagtcggaatttgaggaacggtttttacggagttgggaagatggtttcgctgagatggaattg |
46748733 |
T |
|
| Q |
113 |
gaagtggtgcaattgcggatggagaagaaaggaggtttgttatgttt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46748732 |
gaagtggtgcaattgcggatggagaagaaagggggtttgttatgttt |
46748686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University