View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15073_low_16 (Length: 214)
Name: NF15073_low_16
Description: NF15073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15073_low_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 214
Target Start/End: Complemental strand, 38339475 - 38339271
Alignment:
| Q |
10 |
aagaaaattaacacaattgtacaaatctttgaaagccaatccatatttcccactttgttatgattgttaatgcctaattcactattaaattgtggcttaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38339475 |
aagaaaattaacacaattgtacaaatctttgaaagccaatccatatttcccactttgttatgattgttaatgcctaattcactattaaattgtggcctaa |
38339376 |
T |
 |
| Q |
110 |
attttttggttactgctgtggcctaaattaaccagcttagatctctcttgtaaaaatgaaaataattatttgtcaagtgatcagaacttttaacggcttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38339375 |
attttttggttactgctgtggcctaaattaaccagcttagatctctcttgtaaaaatgaaaataattattcgtcaagtgatcagaacttttaacggcttt |
38339276 |
T |
 |
| Q |
210 |
aaatt |
214 |
Q |
| |
|
||||| |
|
|
| T |
38339275 |
aaatt |
38339271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University