View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15073_low_9 (Length: 319)
Name: NF15073_low_9
Description: NF15073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15073_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 51367480 - 51367171
Alignment:
| Q |
1 |
tgaaaactaaaactaagtccagattaatggacccacccgatgaaccggatagaagatctggtcgggttgctaaatcgagtcagcttttgtccgggatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367480 |
tgaaaactaaaactaagtccagattaatggacccacccgatgaacctgatagaagatctggtcgggttgctaaatcgagtcagcttttgtccgggatgat |
51367381 |
T |
|
| Q |
101 |
tgggaggaaaggtgatgatgatgaagatgatccttttatggaagaggattttccagatgagtataagaaaacacattttagtctctggattcttcttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367380 |
tgggaggaaaggtgatgatgatgaagatgatccttttatggaagaggattttccagatgagtataagaaaacacattttagtctctggattcttcttgaa |
51367281 |
T |
|
| Q |
201 |
tggttgagtttgattttaattattggtgcatcagtaacaactttttgtgttcctttgttgagggaaaagaaactgtggcagcttaagttgtggaaatggg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367280 |
tggttgagtttgattttaattattggtgcatcagtaacaactttttgtgttcctttgttgagggaaaagaaactgtggcagcttaagttgtggaaatggg |
51367181 |
T |
|
| Q |
301 |
aagtgatgat |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
51367180 |
aagtgatgat |
51367171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University