View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15074_high_15 (Length: 224)
Name: NF15074_high_15
Description: NF15074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15074_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 206
Target Start/End: Original strand, 26331229 - 26331423
Alignment:
| Q |
12 |
gagatgaatatccgaaatttccatgaccctgcaatatgtcctgtggaaatgactcctgatttccgttggcaggaagtccagtattattataaagtgaatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26331229 |
gagatgaatatccgaaatttccatgaccctgcaatatgtcctgtggaaatgactcctgatttccgttggcaggaagtccggtattattataaagtgaatt |
26331328 |
T |
|
| Q |
112 |
tgtgaaacttgatgaattggaataacagttaaccgctgagggcctaataggggctggtatgttgctgttggtcagagaatttctgttcagattgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26331329 |
tgtgaaacttgatgaattggaataacagttaaccgctgagggcctaataggggctggtatgttgctgttggtcagagaatttctgttcagattgt |
26331423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University