View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15074_high_9 (Length: 252)
Name: NF15074_high_9
Description: NF15074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15074_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 36 - 144
Target Start/End: Original strand, 41367569 - 41367681
Alignment:
| Q |
36 |
aataatgtttgttgttggtaataatcgatgtaa----aaagctttattgaatgttgttggaatgaaaattaaggaaaggaatcgcacatgatcaggaaca |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41367569 |
aataatgtttgttgttggtaataatcgatgtaattaaaaagctttattgaatgttgttggaatgaaaattaaggaaaggaatcgcacatgatcagcaaca |
41367668 |
T |
|
| Q |
132 |
actttaatttgag |
144 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41367669 |
actttaatttgag |
41367681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University