View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15074_low_9 (Length: 319)
Name: NF15074_low_9
Description: NF15074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15074_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 47365544 - 47365736
Alignment:
| Q |
18 |
ctacatagtgagttttgtattcactttcacctttcatttgtatcaacttaaacccttttttcatagttttccccttctgctaaatgctcaattatttttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365544 |
ctacatagtgagttttgtattcacttttacctttcatttgtatcaacttaaacccttttttcatagttttccccttctgctaaatgctcaattatttttg |
47365643 |
T |
 |
| Q |
118 |
tgacaaacatagtacaattaaggacagacaaactgaaggtgaacttaggaacagatactagaattttatatgcaaatttcacatatttaatac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365644 |
tgacaaacatagtacaattaaggacagacaaactgaaggtgaacttaggaacagatactagaattttatatgcaaatttcacatatttaatac |
47365736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 267 - 313
Target Start/End: Original strand, 47365793 - 47365839
Alignment:
| Q |
267 |
ctttagtggattagattgacaaactgaagtcaccttactatattctt |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365793 |
ctttagtggattagattgacaaactgaagtcaccttactatattctt |
47365839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University