View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_high_10 (Length: 456)
Name: NF15075_high_10
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 406
Target Start/End: Original strand, 42358677 - 42359088
Alignment:
| Q |
1 |
gtatatactctcatttaatgcaatagttatggcacttgattgttgactagtgttgttgttgctgtttactagaaacaatgctgggaagtttgcagaagag |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358677 |
gtatatactctcatttcatgcaatagttatggcacttgattgttgactagtgttgttg---ctgtttactagaaacaatgctgggaagtttgcagaagag |
42358773 |
T |
 |
| Q |
101 |
cacgcaatctctgaggatggagttgaaatgacctttgccactaattatttaggtgagtaagattacaacaaannnnnnn------atttgatatgcatat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42358774 |
cacgcaatctctgaggatggagttgaaatgacctttgccactaattatttaggtgagtaagattacaacaatttttatttttttaatttgatatgcatat |
42358873 |
T |
 |
| Q |
195 |
aatttaat-taattaat--atattgtggtgcaggtcattttgtgttgacaaaaatgttgatgaagaagatggttgaaacggcaaaggagacagggataga |
291 |
Q |
| |
|
||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42358874 |
aatataatataattaattaatattgtggtgcaggtcattttgtgttgacaaaaatgttgatgaagaagatggttgaaacggcaaaggagacagggattga |
42358973 |
T |
 |
| Q |
292 |
aggaaggatagtgaacgtgtcgtccgcaatacacggttggtttactggcgacgtcatctcctatttggctcatatatgccgcaacaaaaggtgacaaata |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358974 |
aggaaggatagtgaacgtgtcgtccgcaatacacggttggtttactggcgacgtcatctcctatttggctcatatatgccgcaacaaaaggtgacaaata |
42359073 |
T |
 |
| Q |
392 |
actactattatctta |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42359074 |
actactattatctta |
42359088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University