View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_high_17 (Length: 405)
Name: NF15075_high_17
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 1 - 397
Target Start/End: Original strand, 7572584 - 7572980
Alignment:
| Q |
1 |
ttttagagctttaatagaatcacagtgacattgtgattttgtcaaatttacctcgaattcaaacatgaatttagatctgacagttctacaaccacataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7572584 |
ttttagagctttaatagaatcacagtgacattgtgattttgtcaaacttacctcgaatccaaacatgaatttagatccgacagttctacaactacataaa |
7572683 |
T |
|
| Q |
101 |
tggtgcagttgttgcagaggatctagacaaccaaatttcacaatttcatacgaaagaggatttggatcctctcctactatgtaacggtgcagcaaaattt |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7572684 |
tggtgcagttgttgcagaggatccagacaaccaaatttcacaatttcattcgaaataggatttggatcctctcctactatgtaacggtgcagcaaaattt |
7572783 |
T |
|
| Q |
201 |
ttgtaactaggacggcataacaccgcttgcggtagcactttttacacgaatattttttgctgcactattgcatcgtaggataggatccgagtccttcaaa |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7572784 |
ttgtaactaggacggcatacaaccgcttgcggtagcactttttacacgaatattttttgctgcactattgcatcgtaggataggatccgagtccttcaaa |
7572883 |
T |
|
| Q |
301 |
ataacatttgacaagtttgtattttttatgagattgcttcactcacagctgtcacgatgaaataaggagtgtaaaacaaatgaacccatctctctgc |
397 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7572884 |
ataacatttgacaagtttgtattttttacgagattgcttcactcacagctgtcacgatgaaataaggagtgtaaaacaaatgaacccatctctctgc |
7572980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 337 - 397
Target Start/End: Complemental strand, 11459875 - 11459815
Alignment:
| Q |
337 |
cttcactcacagctgtcacgatgaaataaggagtgtaaaacaaatgaacccatctctctgc |
397 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
11459875 |
cttcactcacagatgtcacattaaaataaggagtgttgaacaactgaacccatctctctgc |
11459815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University