View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_high_20 (Length: 393)
Name: NF15075_high_20
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_high_20 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 256 - 393
Target Start/End: Complemental strand, 27424145 - 27424008
Alignment:
| Q |
256 |
taacttgatagcatataaaagcttttggtaaattaacagaatgattctttcaagaagacgggatgctacaatttagattgttcaggttttgttcaagccg |
355 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27424145 |
taacttgatggcatataaaagcttttggtaaattaacagaatgattctttcaagaagacgggatgctacaatttagattgttcaggttttgttcaagccg |
27424046 |
T |
 |
| Q |
356 |
ataatacaattactccaggtcaatcattcatcaaaaca |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27424045 |
ataatacaattactccaggtcaatcattcaacaaaaca |
27424008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 90 - 189
Target Start/End: Complemental strand, 27424311 - 27424212
Alignment:
| Q |
90 |
gtgaacagcttgttaattttgtaatattatatacaatgtctaacatagactcaaaattatgttaggtgcttcctcaattatacaatgacgacctaactca |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27424311 |
gtgaacagcttgttaattttgtaatattatatacaatgtctaacatagactcaaaattatgttaggtgcttcctcaattatacaatgacgacctaactca |
27424212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 10 - 63
Target Start/End: Complemental strand, 27424393 - 27424340
Alignment:
| Q |
10 |
agataattctaatataatcacaattggatggcatgtgagtataaatttatgtaa |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27424393 |
agataattctaatataatcacaattggatggcatgtgagtataaatttatgtaa |
27424340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University