View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_11 (Length: 454)
Name: NF15075_low_11
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 210 - 274
Target Start/End: Complemental strand, 48548384 - 48548320
Alignment:
| Q |
210 |
gaaatcaaatgtagaattgaaatgatgtttttgcactcactctcgcccttcttctctactctctc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48548384 |
gaaatcaaatgtagaattgaaatgatgtttttgcactcactctcgcccttcttctctactctctc |
48548320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 6 - 96
Target Start/End: Complemental strand, 48548600 - 48548510
Alignment:
| Q |
6 |
agaagcaaagggtatagttagttacgagaatggcatcaatatcgtcttcgggagaaagcnnnnnnncttccctgcgagctcgtttcatatc |
96 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
48548600 |
agaagcataaggtatagttagttacgagaatggcatcaatatcgtcttcgggagaaagctttttttcctccctgcgagctcgtttcatatc |
48548510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 48548242 - 48548196
Alignment:
| Q |
394 |
atttgctttcatgaatagtgtttgtcattgaacctggagtgtgtttt |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48548242 |
atttgctttcatgaatagtgtttgtcattgaacctggagtgtgtttt |
48548196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University