View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15075_low_44 (Length: 247)

Name: NF15075_low_44
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15075_low_44
NF15075_low_44
[»] chr4 (1 HSPs)
chr4 (1-240)||(41345203-41345442)


Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 41345203 - 41345442
Alignment:
1 catgttcctgattatgacttgtttgttgaacattgcttgtttcgttcattgacgatggagctgtttctattggcaaactctggtcaggattaatactcgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
41345203 catgttcctgattatgacttgtttgttgaacattgcttgtttcgttcattgatgatggagctgtttctattggcaaactctggtcaggattaatactcgt 41345302  T
101 ttccggaacaatggttgctatttcattcactgataatggagttgtttccattaccatattacccatttcggatcttggtctacgagaagatcgatatcgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
41345303 ttccggaacaatggttgctatttcattcactgataatggagttgtttccattatcatattacccatttcggatcttggtctacgagaagatcgatatcgt 41345402  T
201 ggacgacgctgtttttccctttttgcttctaaccattcat 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
41345403 ggacgacgctgtttttccctttttgcttctaaccattcat 41345442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University