View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_45 (Length: 246)
Name: NF15075_low_45
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 11760169 - 11759951
Alignment:
| Q |
18 |
agtgcataattaataagtataaaaatctaaatctgtagtttcaccaaaacaaaaatctaaatttgtaaaatatgaacctgttatattgctggttttcttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11760169 |
agtgcataattaataagtataaaaatctcaatctgtagtttcaccaaaacaaaaatctaaatttgtaaaatatgaacctgttatattgctggttttcttc |
11760070 |
T |
 |
| Q |
118 |
gattcttgttgccaatgtaagacacgctattccaacaatttgaaggtttctttctgctttgaagtatcccttgctcaggaaacggtcaagtagattgatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11760069 |
gattcttgttgccaatgtaagacacgctattccaacaatttgaaggtttctttctgctttgaagtatcccttgctcaggaaacggtcaagtagattgatt |
11759970 |
T |
 |
| Q |
218 |
gcaagaaacattgtctctg |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11759969 |
gcaagaaacattgtctctg |
11759951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University