View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15075_low_46 (Length: 245)
Name: NF15075_low_46
Description: NF15075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15075_low_46 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 245
Target Start/End: Complemental strand, 42454513 - 42454286
Alignment:
| Q |
20 |
aatagcactacagtgccttaaatccnnnnnnnn-gccttgccaaaatacaaggtctttcaccaaaattccatgttcgattcatctttgagccannnnnnn |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42454513 |
aatagcactacagtgccttaaatcctttttttttgccttgccaaaatacaaggtctttcaccaaaattccatgttcgattcatctttgagccattttttt |
42454414 |
T |
 |
| Q |
119 |
nnnnnnnnn-caactgtgccatataattaatacgatatatgtacattggctctaactcaaccattacaaaaccggtttgtatggagagggctacctcatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42454413 |
ctttctttttcaactgtgccatataattaatacgatatatgtacattggctctaactcaaccattacaaaaccggtttgtatggagagggctacctcatc |
42454314 |
T |
 |
| Q |
218 |
actgataaacacgttttcggactatatc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42454313 |
actgataaacacgttttcggactatatc |
42454286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University